European Ocean Biodiversity Information System

[ report an error in this record ] Print this page

Bacteria in Antarctic glacial foreland soils
Citation
Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y (2018): Bacteria in Antarctic glacial foreland soils. v1.3. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils&v=1.3 https://doi.org/10.15468/6pzeer
Contact: Yan, Wenkai

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient. more

Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis.

Study Extent: Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013.

Method step description:

  1. Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements.
  2. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions.
  3. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States).

Scope
Keywords:
Terrestrial, Dna sequencing, Glacial soils, Metadata, Antarctica, Bacteria

Geographical coverage
Antarctica [Marine Regions]

Temporal coverage
February 2013

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Molecular data

Contributors
Shanghai Jiao Tong University (SJTU)data creator
Yan, Wenkai
Xiao, Xiang
Zhang, Yu
Polar Research Institute of China (PRIC)data creator
Ma, Hongmei
Shi, Guitao
Sun, Bo

Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System
(Partly) included in:
RAS: Register of Antarctic Species

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2019-03-29
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy