[ report an error in this record ] |
Antarctic snow algae communities
Citation
Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. Https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.1 https://doi.org/10.15468/hvpvwh
Contact:
Davey, Matthew
Availability: This dataset is licensed under a Creative Commons Attribution 4.0 International License.
Description
Amplicon sequencing dataset of Eukaryotes (18S-ITS) and Bacteria (16S) in green and red snow algae blooms on Antarctic snow. more
Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.
Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.
Study Extent: Snow algae communities were collected from layers of green and red dominant snow algal blooms at four locations in Ryder Bay, Antarctic Peninsula (Rothera Point, Anchorage Island, Léonie Island and Lagoon Island) in austral summer (Jan–Feb) 2015.
Method step description:
- Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
- Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
- The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.
Scope
Keywords:
Terrestrial, Algal blooms, Dna sequencing, Metadata, Snow, Antarctica, Bacteria
Geographical coverage
Antarctica [Marine Regions]
Temporal coverage
From 2015 on [Completed]
Taxonomic coverage
Bacteria [WoRMS]
Parameter
Molecular data
Contributors
University of Cambridge, data creator
Davey, Matthew
Norman, Louisa
Sterk, Peter
Huete-Ortega, Maria
BunBury, Freddy
Kin Wai Loh, Bradford
Smith, Alison
Norman, Louisa
Sterk, Peter
Huete-Ortega, Maria
BunBury, Freddy
Kin Wai Loh, Bradford
Smith, Alison
Natural Environment Research Council; British Antarctic Survey (BAS), data creator
Peck, Lloyd
Conevy, Peter
Newsham, Kevin
Conevy, Peter
Newsham, Kevin
Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System
(Partly) included in:
RAS: Register of Antarctic Species
Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2019-03-28
Information last updated: 2019-04-10